silvio.catalog package

Submodules

silvio.catalog.RecExpSim module

An experiment that uses hosts which implements all currently existing modules.

class silvio.catalog.RecExpSim.GrowthOutcome(value: Union[pandas.core.frame.DataFrame, pandas.core.series.Series], error: Optional[str] = None)

Bases: silvio.outcome.DataWithPlotOutcome

make_plot() → matplotlib.figure.Figure

Plotting with pyplot is unfortunately unintuitive. You cannot display a single figure by using the object-oriented API. When you do plt.subplots (or create a plot by any other means) it will be stored in the global context. You can only display things from the glbbal context, and displaying it will remove it from there.

class silvio.catalog.RecExpSim.RecExperiment(seed: Optional[int] = None, equipment_investment: int = 0, max_budget: int = 10000)

Bases: silvio.experiment.Experiment

Recombinant Expression Experiment with culture growth and genetic recombination. Has a budget system to limit bruteforcing.

_abc_impl = <_abc._abc_data object>

build_ecol_host(name: str, seed: int) → silvio.catalog.RecExpSim.RecHost

build_pput_host(name: str, seed: int) → silvio.catalog.RecExpSim.RecHost

clone_with_recombination(host_name: str, primer: Bio.Seq.Seq, gene: silvio.extensions.records.gene.gene.Gene, tm: int) → Tuple[silvio.catalog.RecExpSim.RecHost, str]

Clone the host while trying to insert a gene. The Clone might or might not contain the added Gene. Returns: ( new_host, outcome_message )

create_host(species: Literal[ecol, pput], name: Optional[str]) → silvio.catalog.RecExpSim.RecHost

find_host_or_abort(host_name: str) → silvio.catalog.RecExpSim.RecHost

Find a host by a given name or abort with an exception. Throws: ExperimentException

measure_promoter_strength(host_name: str, gene_name: str) → silvio.outcome.DataOutcome

Measure the promoter strength of gene gene_name inside host host_name.

print_status() → None

simulate_growth(host_name: str, temps: List[int], wait: float = 0.001) → silvio.catalog.RecExpSim.GrowthOutcome

Simulate a growth under multiple temperatures and return expected biomasses over time.

simulate_vaccine_production(host_names: List[str], gene_name: silvio.extensions.records.gene.gene.Gene, cult_temp: int, growth_rate: float, biomass: int) → silvio.outcome.DataOutcome

Simulate the protein production of multiple host cultures.

spend_budget_or_abort(amount: int) → None

Each operation may use up a certain amount of the budget. When the budget is not sufficient those operations will all fail. By using error handling via raised exceptions we don’t need to check each method for a success flag on their return value. Throws: ExperimentException

class silvio.catalog.RecExpSim.RecHost(ref: Optional[Host] = None, name: str = None, seed: Optional[int] = None, **kwargs)

Bases: silvio.host.Host

_abc_impl = <_abc._abc_data object>

copy(ref: silvio.catalog.RecExpSim.RecHost) → None

Make a copy of the host params and modules by using another similar Host as a reference. The code inside this method should provide a good copy where shallow and deep copies are used appropriately.

Extending Hosts should have the following structure on their method:

find_gene_or_abort(gene_name: str) → silvio.extensions.records.gene.gene.Gene

Find a gene by a given name or abort with an exception. Throws: HostException

insert_gene(gene: silvio.extensions.records.gene.gene.Gene) → None

make(opt_growth_temp: int, max_biomass: int, infl_prom_str: int, species_prom_str: int, opt_primer_len: int, regressor_file: pathlib.Path, addparams_file: pathlib.Path) → None

Make a new host from scratch with the help of arguments. Set possible params and modules.

Extending Host should have the following structure on their method:

print_status() → None

ref_prom = 'GCCCATTGACAAGGCTCTCGCGGCCAGGTATAATTGCACG'

sync() → None

Run the sync procedure on this host. It usually only calls the sync of each module using a helper method for that.

Extending Hosts should have the following structure on their method: